
Name of the heading
BRCAs are a set of genes that encode DNA repair proteins. Humans have two of these genes, BRCA1 and BRCA2. One is inherited from the mother, while the other is from the father. When our BRCA genes are normal, they are able to stop cancer cells from taking over the body. They are also called tumor-suppressor genes because of what they do.
In some people, the BRCA genes are defective and have lost their ability to stop tumors from forming. Those with erroneous versions of BRCA1 or BRCA2 are more vulnerable to developing breast cancer. Most of these people are women. In fact, in 2020, statistics show that more than 2.3 million women worldwide were diagnosed with breast cancer. This disease also claims about 685,000 lives each year.
Detecting defective variants, or mutations, of BRCA1 or BRCA2 is key to predicting the likelihood of breast cancer. Modern medical science has given the necessary tools to diagnose BRCA mutations. These techniques involve molecular biology and genetics.
Students learning a cancer genetics topic for the first time might feel intimidated by the material. But there are many ways to make it more engaging and approachable. Read on to find out how.
First of all, let’s take a look at why students find it challenging to learn BRCA mutations. Here are the top three reasons experienced by both students and teachers.
Genes have no visual representations other than their sequences of genetic letters. Genes are composed of combinations of four nucleotide bases – Adenine (A), Thymine (T), Guanine (G), and Cytosine (C) – which serve as the “alphabet” of our genetic code.
If students see a sequence of a gene that looks like this:
AATGAACCTGCCGTTATGTTGGGCTTCCAAA
The letters can be extremely hard to make sense of. It looks a bit like computer code, which is similarly hard to decipher on its own. Like computer code, genes need to be decoded for them to make sense.
Detecting BRCA mutations involves many intricate procedures that involve molecular biology. These include techniques like:
Students need to know the basics of these techniques before they can fully understand BRCA mutations. The amount of material to cover may pose a challenge for many of them.
Before students can learn BRCA mutations, they need to have a good grasp of a large volume of fundamental concepts in molecular biology. They need to know the basics of genetics, DNA replication, mutations, cell division, cell cycle controls, and cancer progression, among others.
If students are not well-versed in these foundational topics, they will have a hard time comprehending lessons about BRCA mutations.

DNA replication overview (Image source: Wikimedia Commons)
Based on the difficulties students have when studying BRCA mutations, here are five tips for educators to make the topic more interesting. Each piece of advice addresses a particular challenge that students face.
If teaching BRCA mutations can be made more approachable for students, they will gain mastery more quickly. They will also recall key concepts more easily when they take higher biology or medicine courses.
BRCA mutations hold a significant spot in the real world. Diagnosing breast cancer early, for one, can prevent the deaths of hundreds of thousands of people globally each year. In other words, this topic can save lives.
It may be helpful to point out to students that the women in their lives might be vulnerable. Their mothers, sisters, and aunts will certainly benefit from knowing whether or not they have BRCA mutations. If they do, and if the mutations are detected early, students can help their female loved ones take appropriate measures to decrease the chances of getting breast cancer later in life.
Early detection of breast cancer can also save people a lot of money down the line. When preventive measures are taken, potential cancer sufferers will no longer have to experience the disease.
Photographs, diagrams, illustrations, and videos are helpful in making students understand BRCA mutations and its underlying concepts more easily. Students can appreciate molecular biology lab techniques a lot better when their learning is aided by pictures and videos.
Videos, in particular, can make teaching practical concepts easier. Students can replay video demonstrations of PCR, AGE, and other meticulous methods as much as they need to. This way, they can have a good grasp of the basic skills they need even before working on a lab bench.
Interactive simulations are even better. They let students manipulate lab instruments and reagents virtually, so it’s as if they’re doing the real thing. If they make mistakes, no real objects will break, it will not cost anything, and they are at no risk of injury. Once they master the technique in the virtual world, they will be more confident as they perform actual experiments in the real lab. The image below is from Labster’s simulation entitled Cancer: Impact of BRCA mutations.
Before students can properly learn BRCA mutations, they need to have mastered the basics. It is a good idea to ensure that students have mastered a number of fundamental concepts.
First of all, students need to know that genes are composed of DNA, and that DNA comprises a code of four letters – A, T, C, and G. Combinations of these letters form genes, which encode instructions for building the different parts of the human body. Each gene encodes a specific protein, and different proteins have different functions in the body. In the case of BRCA genes, they code for proteins responsible for stopping tumor formation.
Students must also know that genes have normal and defective versions. Defective genes can cause diseases, especially cancers. These defects are often caused by mutations in the gene, which are alterations of their normal letter codes. Individuals having mutations in either the BRCA1 or the BRCA2 gene are at much greater risk for breast cancer.
Another key concept is that genes can be sequenced to determine the precise letter codes in each person. DNA can be extracted from blood samples, then BRCA genes can be separated from the rest of the person’s DNA. Finally, the separated BRCA genes can be sequenced to determine if there are mutations.
Mutations in the BRCA genes themselves may sound abstract to many students. Terms like point mutations, frameshift mutations, and missense mutations are hard to appreciate on their own. But if the implications for human health are discussed along with them, students can better make sense of BRCA mutations.
The most pronounced effect of mutations in the BRCA genes is breast cancer. The manifestations of this disease include tumors in the breast and, if the condition is not addressed early, can cause the cancer cells to spread to other organs. At this point, the cancer is termed metastatic, and if it is still not treated, cancer cells may spread to the entire body. As cancer cells spread to more organs, the condition becomes more fatal.
One drastic treatment to stop the spread of breast cancer is a procedure called mastectomy. Here, one or both breasts are removed by surgery. Before and after photographs of patients who have undergone mastectomy may help students understand the serious nature of this topic.
Virtual lab simulations are excellent tools for teaching BRCA mutations. Labster is determined to deliver fully interactive advanced laboratory simulations that make use of gamification elements like storytelling and scoring systems while exposing students to an immersive, realistic, 3D environment.
Check out this simulation of Cancer: Impact of BRCA mutations at Labster. This activity will let students explore how cancer progresses and the effects of BRCA mutations on the human body. After learning all about it, your students can be more confident when they will do it on their own in a real lab! The image below is an example of what students can explore in the simulation.
Please take a look at the following image from the Labster’s Virtual Lab called Cancer: Impact of BRCA mutations or get in touch to find out how you can start using virtual labs with your students.

Lorem ipsum dolor sit amet, consectetur adipiscing elit, sed do eiusmod tempor incididunt ut labore et dolore magna aliqua. Ut enim ad minim veniam, quis nostrud exercitation ullamco laboris nisi ut aliquip ex ea commodo consequat. Duis aute irure dolor in reprehenderit in voluptate velit esse cillum dolore eu fugiat nulla pariatur.
Block quote
Ordered list
Unordered list
Bold text
Emphasis
Superscript
Subscript
See our plan options, learn more about virtual labs, and find out how easy it is to get started with Labster.
